For the bayou biolabs mmp18 sequence, please click here. Why are two different restriction enzymes used to cut the. Dna synthesis initiated at the origin was made to terminate precociously in an inserted sequence of 18 base pairs that is homologous to a sequence in the origin. In the first article in this series, we talked about how origins of replication ori control plasmid replication and copy number. Methods in molecular biologymethods in molecular biology tm volume 235 edited by nicola casali andrew preston e. Swisspdbviewer aka deepview is an application that provides a user friendly interface allowing to analyze several proteins at the same time. Snapgene viewer is revolutionary software that allows molecular biologists to create, browse, and share richly annotated dna sequence files up to 1 gbp in length. Bacillus megaterium high performance expression vectors pdf. Plasmids pbr322 and puc8 pbr322 plasmid one of the first plasmids to be used in recombinant genetics was called pbr322. The fabi cassette in pfab can be transferred to other pucderived plasmids using the aatii and alwni restriction sites. Snapgene viewer includes the same rich visualization, annotation, and sharing capabilities as the fully enabled snapgene software. To determine transformation efficiency, add 1 l of the puc19 control dna to a microcentrifuge. The features of this puc19 plasmids are as follows.
The puc18puc19 sequence is stored as a pdffile on the genaxxon webpage it can be downloaded from the. The effect of increasing plasmid size on transformation efficiency in escherichia coli vicky chan, lisa f. Nov 26, 2014 today i would like to introduce you to puc18, a plasmid most noted for its high copy number. Standard cloning vector phagemid excised from lambda zapii. Addgene ngs result gagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccg. Mattenley department of microbiology and immunology, ubc based on the observation that the transformation of escherchia coli was more efficient with puc19 than with the larger. It contains the pmb1 origin of replication from pbr322, but it lacks the rop gene and carries a point mutation in the rnaii transcript g 2975 in pbr322 to a 8 in puc19. The designation puc is derived from the classical p prefix denoting plasmid and the abbreviation for the university of california, where early work on the plasmid series had been conducted. The bayou biolabs mmp18 sequence has a few differences from the mmp18 sequence reported in genbank, accession number x025. Use experimental dna that is free of phenol, ethanol, salts, protein, and detergents to obtain maximum transformation efficiency. Aug 11, 2008 the puc19 multiple cloning site mcs is retained, however hincii, hindiii and psti are not unique in pfab. If you are having trouble with crashing in mojave or catalina, redownload to get the latest update. High copy number of the puc plasmid results from a romropsuppressible point mutation in rna ii. This material is available to academics and nonprofits only.
The molecule is doublestranded circle, 2686 base pairs in length, and has a high copy number. Why are two different restriction enzymes used to cut the puc19 plasmid and the lux gene dna. After amplifying a promoter sequence, transgene and activation domain and polya signal. The site of initiation of dna replication at the plus origin was mapped to within an 8basepair sequence.
This plasmid has been modified to carry a gene for resistance to ampicillin the socalled ampr gene, which. This vector is designed for cloning and generation of exoiii deletions. Fiveminute cloning of taq polymeraseamplified pcr products. The molecule is a small doublestranded circle, 2686 base pairs in length, and has a high copy number. Use our dna sequences and maps tool to view the sequence files used to produce plasmid vectors, viral and bacteriophage maps from nebs catalog. Plasmid dna from escherichia coli rri has been used for imaging of dna nanostructure via atomic. Marker genes there are a number of plasmids available as commercial vectors that can be purchased. Created in 1977 in the laboratory of herbert boyer at the university of california, san francisco, it was named after francisco bolivar zapata, the postdoctoral researcher who constructed it. The two replication origins of plasmid pub110 have been characterized. The creation of a sizemodified puc19 jennifer roger department of microbiology and immunology, ubc in order to study the exclusion effect observed when escherichia coli dh5. Snapgene viewer free software for plasmid mapping, primer. Xx rn 1 rp 12686 rc mmp18 from mmp8 rc mmp19 from mmp9 rc puc18 from puc8 rc puc19 from puc9 ra yanischperron c. Naturallyoccurring plasmids are viruses of bacteria. It contains identical multiple cloning site mcs as puc18 vector except that it is arranged in opposite orientation.
The effect of increasing plasmid size on transformation. The plasmids designated puc18 or puc19 have been used extensively. A repository of over 200,000 plasmids including protein structure initiative protein expression plasmids and vectors, over 75,000 human plasmids, and whole genome collections from many organisms. Unique restriction sites, so that the restriction enzymes can be used to cut the plasmid and dna of interest can be inserted into the plasmid.
Replication origins of singlestrandeddna plasmid pub110. The puc18 puc19 sequence is stored as a pdf file on the genaxxon webpage. It can be downloaded from the detaisl view of the puc18 puc19 product description. Would you like to move beyond handdrawn plasmid maps. I plan to insert these constructs into a puc19 vector with a downstream. The focus of this study was the construction of a novel enlarged puc19 vector, pbart, which carries the rop and tetracycline resistance genes derived from pbr322. The fabi cassette was also inserted into the mcs of puc19 to obtain pucfa. Construction of an enlarged puc19 vector with a rop gene. Discrepancies between sequencing results obtained by addgene and the original sequence provided by the depositor may be present. Please sign in to view account pricing and product availability. It contains identical multiple cloning site mcs as puc18 vector except that. This vector is not available from the plasmid repository and is provided here only as a reference. The proteins can be superimposed in order to deduce structural alignments and compare their active sites or any other relevant parts. Since plasmid replicon type determines inc group, the terms inc and rep type were interchangeably used to describe plasmid types.
Plasmid dna from escherichia coli rri has been used in polymerase chain reaction pcr. Plasmid selection in escherichia coli using an endogenous. Sequence provided by depositing laboratory may be theoreticalpredicted or based on sangerngs sequencing results. The cut sites for some restriction enzyme are indicated on the plasmid. The artificial plasmid puc18 has been genetically engineered to include 1 a gene for antibiotic resistance to ampicillin amp r, and 2 a gene and its promoter for the enzyme betagalactosidase lacz. It is approximately 4300 bp in length and has two antibiotic resistance genes.
Bacillus megaterium classic expression vectors pdf. The map, notes, and annotations on this page and in the sequencemap file are ed material. Thermo scientific puc19 vector is a small, high copy number, e. Vector systems mobitec molecular biotechnology mobitec gmbh. Initially, inc typing relied on introduction of a plasmid into a strain carrying another plasmid and determining whether both plasmids were stably maintained in the progeny. Pdf high copy number of the puc plasmid result from a rom.
1112 1216 743 1436 3 147 812 1388 204 181 472 938 534 541 640 569 620 1334 1011 1399 176 264 1117 996 648 1018 34 1178 96 847 778 1267 366 1287 1006 370 628 1056 709 729 1084 1389 1223 755 907